Home / CA / 06 July Current Affair For All Competition Exam

06 July Current Affair For All Competition Exam

  1. Uttarakhand HC order declared animals as legal entities
  • The Uttarakhand High Court has declared that “all members of the animal kingdom including birds and aquatic life have similar rights as humans”.
  • It has also ordained that animals throughout Uttarakhand should be treated as “legal entities having a distinct persona with corresponding rights, duties and liabilities of a living person.”
  • The court directed the government to constitute societies for the prevention of cruelty to animals in each district and to appoint infirmaries for the treatment and care of animals.
  • It also directed the government to “enforce the provisions of the Prevention and Control of Infectious and Contagious Diseases in Animals Act, 2009.

Related Information

  • The Uttarakhand HC had in March last year in a similar order declared the rivers Ganga and Yamuna as legal entities but the order was stayed by the Supreme Court three months later.

Every day counts.... Don't waste time.... Prepare With Toppersuurt88ur Be a Part of GATE-IES-PSUs 2018-2019 Success Journey

Like Us On Facebook

Source- Down to Earth

  1. Cabinet approved DNA Technology (Use and Application) Regulation Bill, 2018
  • The primary intended purpose for enactment of “The DNA Technology (Use and Application) Regulation Bill” is for expanding the application of DNA-based forensic technologies to support and strengthen the justice delivery system of the country.
  • The utility of DNA based technologies for solving crimes, and to identify missing persons, is well recognized across the world.

Background

Law Commission report

  • In 2017, the Law Commission of India, in its 271st report, prepared the draft Bill named The DNA Based Technology (Use and Regulation) Bill, 2017 after examining various judicial pronouncements and constitutional provisions.
  • The exercise was initiated by the Commission after the Department of Biotechnology forwarded its draft of ‘The Use and Regulation of DNA based Technology in Civil and Criminal Proceedings, Identification of Missing Persons and Human Remains Bill, 2016’.

Related Information

DNA Profiling (DNA fingerprinting, DNA testing, or DNA typing)

  • DNA profiling is the process where a specific DNA pattern, called a profile, is obtained from a person or sample of bodily tissue.
  • Even though we are all unique, most of our DNA is actually identical to other people’s DNA.
  • However, specific regions vary highly between people. These regions are called polymorphic.
  • Differences in these variable regions between people are known as polymorphisms.
  • Each of us inherits a unique combination of polymorphisms from our parents.
  • DNA polymorphisms can be analysed to give a DNA profile.

Short tandem repeats method for DNA Profiling

  • One of the current techniques for DNA profiling uses polymorphisms called short tandem repeats.
  • Short tandem repeats (or STRs) are regions of non-coding DNA that contain repeats of the same nucleotide sequence.
  • For example, GATAGATAGATAGATAGATAGATA is an STR where the nucleotide sequence GATA is repeated six times.
  • STRs are found at different places or genetic loci in a person’s DNA.
  • To produce a DNA profile, scientists examine STRs at ten, or more, genetic loci. These genetic loci are usually on different chromosomes.

Application of DNA Profiling

  • Identify the probable origin of a body fluid sample associated with a crime or crime scene
  • Reveal family relationships
  • Identify disaster victims

Every day counts.... Don't waste time.... Prepare With Toppersuurt88ur Be a Part of GATE-IES-PSUs 2018-2019 Success Journey

Like Us On Facebook

Source-PIB

  1. Bru tribals
  • Recently, Home Ministry announced a “historic agreement” had been signed among the governments of Mizoram and Tripura and the Mizoram Bru Displaced People’s Forum.
  • The agreement brought to an end a 21-year wait for over 32,000 Bru tribals, who had been displaced from Mizoram and were living in Tripura.

Bru People

  • The Bru are an ethnic group living in Thailand, Laos, and Vietnam.
  • They are closely linked linguistically and culturally to the Mountain Khmer but are heavily influenced by Laos.

Bru (or Reang) tribe in India

  • Bru (or Reang) tribals inhabit parts of some Northeastern states.
  • In Mizoram, they are largely restricted to Mamit and Kolasib districts.
  • Thousands of Brus fled Mizoram and migrated to Tripura after Bru militants gunned down a forest guard inside the Dampa Tiger Reserve on October 21, 1997.

Source- Indian Express

  1. UNESCO to set up Gaming University in Andhra Pradesh
  • United Nations Educational, Scientific and Cultural Organisation (UNESCO) is going to set up a ‘Design University for Gaming’ in Visakhapatnam.
  • They will develop edutech gaming in the state, with the target of providing 50,000 jobs in 10 years.

Every day counts.... Don't waste time.... Prepare With Toppersuurt88ur Be a Part of GATE-IES-PSUs 2018-2019 Success Journey

Like Us On Facebook

Source- Business Standard

  1. Ketogenic diet may improve the efficacy of cancer drugs
  • A ketogenic diet, which is low in carbohydrates and high in fat, may improve the effectiveness of an emerging class of cancer drugs, scientists.
  • Researchers found a strategy to boost the tumour-killing potential of therapies targeted on the insulin-activated enzyme, phosphatidylinositol-3 kinase (PI3K).
    Note-
    Phosphatidylinositol-3 kinase (PI3K)- a family of enzymes involved in cellular functions such as cell growth, proliferation and differentiation.

Source- DD News

  1. Pandharichi Wari
  • “Pandharichi Wari” is Maharashtra’s 700 years old tradition in which devotees of Lord Vitthala called Varkari trace the route to Pandharpur.
  • For this holy function Devotees from all over state gathers in Dehu and Alandi, the native places of Sant Tukaram Maharaj and sant Dnyaneshvar Maharaj in Pune district and the procession starts for its final destination, Pandharpur.

Source- AIR

  1. Election Commission of India launched ‘CVigil’ app
  • The Election Commissioner of India has launched an Android-based mobile application ‘cVigil’ for Indian citizens to report any violation of the model code of conduct during elections.
  • The app will help voters to share malpractice proof with the authorities.

Source-PIB

Every day counts.... Don't waste time.... Prepare With Toppersuurt88ur Be a Part of GATE-IES-PSUs 2018-2019 Success Journey

Like Us On Facebook

 
SELECT YOUR BRANCH :-
GATE 2018 Information
1. GATE 2018 - MECHANICAL ENGINEERING
2. GATE 2018 - ELECTRONICS AND COMMUNICATION ENGINEERING
3. GATE 2018 - ELECTRICAL ENGINEERING
4. GATE 2018 - CIVIL ENGINEERING
5. GATE 2018 - COMPUTER SCIENCE ENGINEERING
6. GATE 2018 - INSTRUMENTATION ENGINEERING
7. GATE 2018 - CHEMICAL ENGINEERING
 
IES 2018 Information
1. IES 2018 - MECHANICAL ENGINEERING
2. IES 2018 - ELECTRONICS AND COMMUNICATION
3. IES 2018 - CIVIL ENGINEERING
4. IES 2018 ELECTRICAL ENGINEERING
...

About gatepsu.in

GATEPSU.IN Is The No- 01 Website For Self Preparation. We have daily 2Lakh Plus Visitors.

Leave a Reply

Your email address will not be published. Required fields are marked *

error: Content is protected !!